Elements with tag identificación

Feb 02, 2021 at 04:29

Código DRU: TRF2020GA023

Entidad/Técnico: Gabinete Técnico Veterinario S.L.

Localización: Zaragoza

El cumplimiento de la legislación actual en materia de identificación animal y registro (RD 947/2005, RD 685/2013), y los posibles cambios y exigencias que se prevén a corto plazo en dicho tema en el ganado ovino y caprino, hace necesario valorar la eficacia y funcionamiento de los dispositivos de identificación electrónica utilizados y permitidos por la legislación para estas especies. Igualmente, también es necesario conocer la eficacia de los distintos sistemas de lectura de dichos dispositivos disponibles en la actualidad.


Feb 02, 2021 at 04:21

Código DRU: TRF2020GA024

Entidad/Técnico: Gabinete Técnico Veterinario S.L.

Localización: Zaragoza

En el presente estudio se ha hecho una estimación inicial de la casuística y motivos de pérdidas de la identificación visual en el ganado ovino y caprino, así como la determinación de las posibles causas de fallo de lectura de los dispositivos electrónicos.

El trabajo realizado sobre un total de 10.709 animales, de los cuales 10.452 han sido de la especie ovina y 257 de la caprina, ha puesto de manifiesto que los errores en la identificación, en general, suponen un 5,2% para la especie ovina y un 17,5% para la especie caprina.

En el caso de la identificación visual, los errores han sido de un 4% en la especie ovina y de un 4,7% en la caprina, destacando que la causa más frecuente de fallo en esta identificación ha sido la pérdida por la rotura del crotal auricular con un 70,4% en la especie ovina. Para la especie caprina no se ha encontrado una causa preponderante de fallo en este dispositivo.


Nov 29, 2017 at 07:16

CITOLIVA y la AEI del sector oleícola INOLEO, presentan mañana, 29 de noviembre, los resultados finales del proyecto “ENTOMATIC”, liderado por la Universitat Pompeu Fabra (UPF) y financiado por el VII Programa Marco, que tendrá lugar en la sede del C.R.D.O. Sierra Mágina (Bedmar, Jaén), en cuya comarca la plaga de la mosca del olivo es endémica.

Nov 09, 2017 at 12:00

La Sociedad Española de Malherbología (SEMh) ha publicado en su web la “Guía Virtual de Identificación de Propágulos de Malas Hierbas”.

Centro de investigación y tecnología Agroalimentaria de Aragón. Montañana. Zaragoza España
Aug 31, 2017 at 04:33

Los canales iónicos desempeñan un papel fundamental en el mantenimiento de la homeostasis celular, uno de los procesos más importantes en la producción vegetal. Los canales de potasio son sumamente interesantes porque transportan los nutrientes que utilizan las células en los procesos fisiológicos. El propósito de este trabajo fue detectar los códigos genéticos para el canal iónico del potasio AKT1 en las raíces de plántulas de pimiento bell. El PCR se estandarizó para la detección de AKT1 y se sintetizó el oligo: AAGATCAGATGCACCTTGACTT (se obtuvo la mejor alineación a una temperatura de 62 °C), para después ser secuenciado y analizado, dando como resultado una identidad del 94-97% en NCBI, con el gen AKT1.

Mar 25, 2013 at 16:00

Un trabajo desarrollado con la colaboración de la Universidad del País Vasco (UPV/EHU) ha identificado más de 400 genes implicados en la respuesta inmune de las plantas, a través de una novedosa estrategia que permite asignar rápidamente funciones a los genes secuenciados.

Dec 11, 2011 at 15:00

Atendiendo a la petición de varios países La Comisión Europea ha aplazado hasta finales de 2014 el periodo para completar el sistema de identificación.

Loading, please wait...